X
تبلیغات
وبلاگ تخصصی گروه زیست شناسی گرمسار - نمونه سوالات تستی زیست پیش دانشگاهی

وبلاگ تخصصی گروه زیست شناسی گرمسار

نمونه سوالات تستی زیست پیش دانشگاهی

سوالات تستی مربوط به فصل اول تا صفحه 50 کتاب پیش دانشگاهی 1

1-     در تریکودینا محصول فعالیت کدام آنزیم دارای آنتی کون آغاز است؟

1- RNAپلیمراز II             پلیمرازIII -3              RNAپلیمرازRNA   4-               RNAپلیمراز پروکاریوتی           

2- کدام در مورد ملکول tRNA نادرست است؟

1- tRNA آعازگر فقط در جایگاه P قرار می­گیرد                       2- توسط دو حلقه­ی خود روی ریبوزوم نگهداری می­شود

3- ساختار سه بعدی آن در سلول شبیه برگ گیاه شبدر است           4- همه­ی آمینواسیدها به نوکلئوتید آدنین­دار tRNA  متصل می­شوند

3- منومر سازنده­ی کدامیک از عواملی که در رونویسی نقش دارند با سایرین متفاوت است؟

1- عامل رونویسی        2- فعال کننده               3- RNAپلیمراز                4- توالی افزاینده

4- اتصال پروتئین تنظیم کننده به کدام به ترتیب سبب روشن و خاموش شدن اپران لک می­گردد؟

1- اپراتور- آلولاکتوز                                   2- آلولاکتوز-  راه­انداز

3- عامل تنظیم کننده- اپراتور                           4- اپراتور- عامل تنظیم کننده

5- در مهندسی ژنتیک در مرحله­ی ساختن DNA نوترکیب استفاده از کدام آنزیم مقدم­تر است؟

1- محدود کننده­ی  DNA           ECORI لیگاز              3- هلیکاز              4- آنزیم RNA پلیمراز

6- اگر در حین ترجمه­ی یک mRNA مفروض 93 رمز از جایگاه A به P انتقال یابد رشته پلی­پپتید تحت رهبری این ملکول  mRNA            چند پیوند پپتیدی خواهد داشت؟

1-93                          2- 92                         3- 94                             4- 95

7- توالی رشته­ی الگوی سازنده­ی ضد رمز GAU کدام است؟

1- CTA -۴             GUA-۳            CUA -۲                                   GTA

8- ملکول RNA با این ترتیب UCUCUCUCU ساخته می­شود با توجه به این که این ملکول در شرایط مناسب برای ساختن       پروتئین در لوله آزمایش قرار می­گیرد حکم صحیح را انتخاب کنید.

1- دو نوع زنجیره پلی­پپتیدی ساخته می­شود که هر کدام فقط دارای یک اسیدآمینه است

2- دو نوع زنجیره پلی­پپتیدی ساخته می­شود که هر کدام دارای سه اسیدآمینه است

3- یک نوع زنجیره پلی­پپتیدی ساخته می­شود که در آن دو نوع اسیدآمینه و یک در میان قرار دارد.

4- یک نوع زنجیره پلی­پپتیدی ساخته می­شود که در آن سه نوع اسیدآمینه وجود دارد.

9- برای توالی قابل ترجمه­ای به صورت TGA بر روی DNA آنتی­کدون متناسب بر روی tRNA کدام است؟

     UGA-۴                TGA- ۳           AGUَ - ۲            ACU- ۱

10- با ایجاد جهش در کپک نورسپوراکراسا ابتدا سنتز کدام یک دچار اشکال می­شود؟

1- برخی آنزیم­ها       2- برخی اسیدهای آمینه          3- تیامین                       4- نیاسین

11- در هنگام ترجمه­ی mRNA زیر هرگاه GGC  به عنوان یک آنتی­کدون در جایگاه A ریبوزوم قرار گرفته باشد کدام کدون در جایگاه P قرار دارد؟           AUGCCGGGCUAC                                                               

1- UAC                  2-GGC                        3- AUG                         4- CCG

12- در RNAهای پیک بالغ یوکاریوتی فقط قسمت­هایی از رونوشت......................

1- اگزون­ها و همه اینترون­ها ترجمه نمی­شوند                    2- اینترون­ها و همه اگزون­ها حذف شده است

3- اینترون­ها ترجمه نمی­شوند                                       4- اگزون­ها و همه اینترون­ها حفظ شده است

13- پیوند بین آخرین tRNA و پلی­پپتید ساخته شده در جایگاه ............. ریبوزوم توسط ............. شکسته می­شود

1- جایگاه RNA-P پلیمراز                                        2- جایگاه-P عامل پایان ترجمه

3- جایگاهA RNA- پلیمراز                                       4-جایگاه A- عامل پایان ترجمه

14- تبدیل mRNA اولیه با سه رونوشت اینترونی به mRNA بالغ در ............. با برقراری .............. پیوند فسفودی استر صورت می­گیرد

1- هسته – 3            2- سیتوپلاسم – 3              3- سیتوپلاسم – 4                    4- هسته – 4  

 15- کدام بیان در مورد DNA  پلازمید صحیح است؟

1- تک رشته­ای فاقد جایگاه آغاز رونویسی                   

 2- تک رشته­ای دارای جایگاه آغاز رونویسی  

3- دو رشته­ای فاقد جایگاه آغاز همانندسازی                 

 4- دو رشته­ای داری آغازهمانندسازی                   

16- در اپران لک چند توالی ساختاری و چند توالی تنظیمی می­توان یافت؟

1- 1و3                        2-3و2                          3- 3و1                        4- 2و3

17- در ژن زیر کدام جهش نقطه­ای تاثیر بیشتری در بروز صفت ایجاد می­کند؟

DNA…AAATACTTTACAGGGCCCATCATT   

mRNA    UUUAUGAAAUGUCCCGGGUAGUAA 

1-  TACT  ...... ... .....        TACTT                              2- ACG ..........  ACA

3- ATTT ........     ATCATT                        4- GCC   ............   GGGCCC

18- جهش در کدام سلول نمی­تواند به نسل بعد منتقل شود؟

1- آنتروزوئید         2- اسپرماتوزوئید       3- تخم تریپلوئید گیاهان          4- تخم دیپلوئید گیاهان

19- در ویروس آبله گاوی که با روش مهندسی ژنتیک ژن ویروس هرپس تناسلی را دریافت کرده کدام وجود ندارد؟

1- DNA حلقوی     2- پروتئین سطحی هرپس     3- پروتئین سطحی آبله       4- DNA نوترکیب

20- در اپران لک پس از اتصال آلولاکتوز به پروتئین تنظیم کننده ............

1- سه ملکول RNA ساخته می­شود                    2-یک ملکول RNA ساخته می­شود                   

3- مهارکننده بر اپراتور قرار می­گیرد                    4- مسیر حرکتRNA  پلیمراز مسدود می­شود

+ نوشته شده در  دوشنبه چهارم آبان 1388ساعت 13:16  توسط مهناز نسیمی  |