X
تبلیغات
وبلاگ تخصصی گروه زیست شناسی گرمسار - نمونه سوال

وبلاگ تخصصی گروه زیست شناسی گرمسار

سوالات و پاسخنامه آزمون عملی مسابقه آزمایشگاه زیست شناسی شهرستان گرمسار 1390

ايستگاه شماره 1:(15امتياز)(ماهيچه،اسكلت، مولكول RNA، وسايل آزمايشگاهي)

 1-  ماهيچه بين دنده­اي         

 2- ماهيچه راست شكمي                   3- ماهيچه ذوزنقه­اي        

 4- ماهيچه دو سرران              5-   ترقوه         

 6- زند زبرين        7- دنبالچه      

 8- استخوان كف پا    

 9-   بازملكول RNA             

۱۰- قند ملكولRNA   

۱۱- ملكول RNA                                      

 12-  ظرف پتري­ديش                          13-  اسكالپل                   

   14-  سوند                                        15- لانست

ايستگاه شماره2: (14امتياز)(نيم تنه، دستگاه تنفس، نخاع، گوش،پوست)

1-مري                      2- طحال                        3-  روده كور                 

 4- كارديا                     5- تيروئيد                 6-  ديافراگم                   

7-  عصب مختلط        8-  مجراي اپانديم  

 9- استخوان گيجگاهي                  

 10-  عصب شنوايي                         

11-شيپور استاش                       12- استخوان چكشي                   

13- غده عرق                  14-عضله راست كننده مو

ايستگاه شماره3: (16امتياز)(اندام­هاي داخلي بدن مرغ، مراحل تقسيم ميتوز و ميوز، مولاژبافت ساقه و برگ،ساختمان گل در نهاندانه،نمونه­هاي گياهي طبيعي)

1-    چينه­دان                                             2- كليه

3-   الف-  پروفاز ميتوز                                            ب- نوع سلول گياهي

4- الف- پروفاز ميوز1                                             ب- تقسيم ميوز

5- الف- بافت متعلق به ساقه                           ب- اسكلرانشيم در ساقه

6-  كوتيكول در برگ                  7 – پارانشيم چوب در برگ      

8-  تخمك در گل                       9-  كيسه گرده        

10- الف- گياه نهاندانه و دو لپه   

 ب-  شيوه تكثير رويشي(قلمه زدن)                       

11- نهاندانه تك لپه                                     12- بازدانگان

ايستگاه شماره4 : (5امتياز)(ميكروسكوپ، تعيين مقياس،تعيين گروه خوني، تهيه گسترش خوني)

1-ديافراگم ميكروسكوپ                   2- پيچ تنظيم ميكروسكوپ                  

3- تعيين مقياس:مقياس=طول شيئ تقسيم برطول تصوير=01/0(نمونه

 2/mm0  وتصوير2cm)

4- تعيين نوع گروه خوني:- A                                     - تهيه گسترش خوني

ايستگاه شماره 5: (3امتياز)( كوپ ميكروسكوپي نمونه بافت گياهي و جانوري

  1-  ماهيچه مخطط                      2-  بافت عصبي          

  3- ريشه دو لپه

ايستگاه شماره6: (4امتياز)(رعايت موارد: نحوه برش­گيري، رنگ_آميزي، ضخامت نمونه، نحوه قرارگيري لام روي نمونه)

برش­گيري عرضي از مقطع ساقه

ايستگاه شماره7: (12امتياز)

1-      مغز)

سوزن سفيد: برجستگي چهارگانه      سوزن سبز:  بطن 4     

 سوزن قرمز:دستگاه ليمبيك

2-      قلب)

 سوزن زرد:  دريچه سيني        سوزن سبز:سرخرگ آئورت    

 سوزن صورتي:عضلات پاپيلر

3-      كليه)

سوزن آبي:لگنچه        سوزن سفيد: هرم                   سوزن قرمز:ميزناي

4-      چشم)

 سوزن سبز: اجسام مژگاني          سوزن بنفش: زجاجيه     

 سوزن زرد:شبكيه

ايستگاه شماره8: (6امتياز)(رعايت موارد غشاء خارجي و داخلي، ريبوزوم ،ماتريكس، DNA، كريستا)

مدل­سازي ميتوكندري

ايستگاه شماره9: (5امتياز): (تاثير دو محيط با غلظت­هاي مختلف بر روي سلولهاي گياهي)

 طراحي آزمايش: اشاره به محيط­هاي نمكي با غلظت مختلف و اشاره به پديده تورژسانس و پلاسموليز در سلول گياهي

 

 

 

 

 

+ نوشته شده در  چهارشنبه بیست و چهارم فروردین 1390ساعت 21:37  توسط مهناز نسیمی  | 

سوالات و پاسخنامه آزمون تئوری مسابقه آزمایشگاه زیست شناسی شهرستان گرمسار سال 1390

1- به شکل مقابل نگاه کنید وقتی که صفحه پلاستیکی به طرف داخل بطری حركت مي­كند حجم و فشار داخل بطری چه تغییری را نشان مي­دهد؟

1) کم – کم                                   2) کم – زیاد

3) زیاد – زیاد                               4) زیاد – کم

 2- معرف Co2 چه نام دارد- اگر دی اکسید کربن در آن دمیده شود به چه رنگی در می آید؟

1) آب آهک – زرد رنگ                 2) بي­كربنات – زرد رنگ

3) آب آهک – شیری رنگ              4) گزینه ۱و۲ صحیح است

 3- شکل مقابل دستگاه تنفس کدام جانور را نشان می دهد؟

1) کرم خاکی                                 2) زنبور

3) موش                                     4) ماهی

 4- در چه زمانی فشار مایع جنب کاهش می یابد؟

1) در هنگام بالا رفتن دنده ها و پایین آمدن دیافراگم

2) در هنگام پایین آمدن دنده ها و بالا رفتن دیافراگم

3) در هنگام پایین آمدن دنده ها و پایین آمدن دیافراگم

4)  در هنگام بالا رفتن دنده ها و بالا رفتن دیافراگم

5- در  کدام یک از جانوران زیر دستگاه عصبی از شبکه عصبی تشکیل شده است؟

1) هیدر                   2) پلاناریا                3) کرم خاکی            4) مگس

 6- کدام گزينه پاسخ صحیح  را در مورد شكل مقابل نشان مي­دهد؟

1) 1- بصل النخاع، 2- پل مغزی       2) 1- پایک مغزی، 2- مخچه

3) 1- پل مغزی، 2- مخچه               4) 1- پل مغزی، 2- بصل النخاع

 7- دستگاه عصبی زیر مربوط به کدام جانور است؟

1) سگ                                       2) قورباغه

3) کبوتر                                     4) کروکودیل

8- حجم کدام یک در چشم انسان بیشتر است؟

1) زجاجیه                                    2) زلالیه

3) عدسی                                     4) گزينه1 و2 صحيح است

 9- در بیماری نزدیک بینی قطر کره چشم چگونه است؟

الف) طبیعی است                           ب) بزرگتر از حد معمول است

ج) کوچکتر از حد معمول است                   د) هيچكدام

 10- منشاء قرنیه چشم كدام بافت است؟

1) پوششی                2) پیوندی                3) عصبی                4) عضلانی

 11- انقباض ماهیچه دو سر بازو باعث کدام عمل می شود؟

1) باز شدن دست از ناحیه آرنج                  2) استخوان ساعد را روی بازو تا می کند

3) چرخش دست                                   4) حرکت دست به سمت پشت

 12- کدام ماهیچه به زردپی آشیل متصل است؟

1) ماهیچه دو سر ران                            2) ماهیچه خیاطه

3) ماهیچه توام                                   4) ماهیچه چهار سر ران

 13- كدام گزينه درست است؟

1) سلول­هاي ماهیچه مخطط  و ماهیچه ی قلبی چند هسته ای هستند.

2) سلول ماهیچه مخطط تک هسته ای و ماهیچه ی قلبی چند هسته ای است.

3) سلول­هاي ماهیچه مخطط وماهیچه ی قلبی تک هسته ای هستند.

4) سلول ماهیچه مخطط چند هسته ای و ماهیچه ی قلبی تک هسته ای است.

 14- پوست و گوش كداميك از انواع گيرنده ها را دارا مي باشند؟

1) گيرنده شيمايي       2) گيرنده مكانيكي      3) گيرنده درد            4) هيچكدام

15- در كدام سياهرگ ششي وجود ندارد؟

1)ماهي                            2) كانگورو                3) گنجشك               4) لاك­پشت

  16- خط تيره M در كدام قسمت از ساركومر مشاهده مي شود؟

1) در ابتداي ساركومر                            2) در وسط  نوار روشن

3) در انتهاي ساركومر                          4) در وسط صفحه هنسن

17- كدام گزينه بافت زردپي را تشكيل مي­دهد ؟

1) بافت پيوندي سست                         2) بافت چربي

3) بافت پيوندي رشته اي                     4) بافت خوني

 18- ساختار كدام بخش استخوان از نوع بافت متراكم است؟

1) بخش خارجي استخوان­هاي كوتاه         2) بخش مياني استخوان­هاي كوتاه

3) بخش مياني استخوان­هاي پهن             4) گزينه 1 و 3صحيح است

 19-  كدام گيرنده پوست فاقد پوشش است و از بقيه فراوان تراست؟

1) لمس                            2) درد             3) سرما                 4) فشار

20- احساس درد مربوط به كدام بخش از دستگاه عصبي است؟

1) پايانه هاي برهنه اعصاب حسي پوست         2) قشر خاكستري مخ

3) هسته هاي خاكستري درون مخ                   4) بن هاي مايسنر

21- استخوان بازو از قسمت بالايي به كدام استخوان مفصل شده است؟

1) ترقوه                  2) كتف                             3) شانه                   4) دنده

 22- كدام سلول زنده مي­ تواند فاقد اندامك باشد؟

1)آبكش                           2)همراه                              3) پارانشيم                       4)اپيدرم

23- كدام ماهيچه هم از سطح شكمي و هم از سطح پشتي بدن مشاهده مي شوند؟

1) جناغي – ترقوي پستاني          2) دلتايي             3) مورب خارجي                   4) توام

24- كدام نوعي حركت تنجشي است؟

1)    باز شدن كپسول اسپوروفيتي در خزه          2) باز و بسته شدن برگ گل ابريشم  

3 ) رشد مارپيچي نوك ساقه­ي گياهان پيچنده      4) خم شدن ساقه­ي نورسته­ي گياهان به سمت نور

25- رباط و مايع مفصلي در بين كدام دو استخوان وجود ندارد؟

1) ران و لگن                                        2) ران و درشت ني

3) بازو و كتف                                       4) ران و نازك ني

26- تعداد رگ هاي متصل به دهليز چپ قلب چند عدد است ؟

 1)چهار                2) سه               3) دو              4) يك

 27- كدام گزينه در مورد ديواره ي سرخرگ ها و سياهرگ ها صحيح است ؟

1)ديواره ي سرخرگ ضخيم تر و داراي خاصيت ارتجاعي بيش تر از سياهرگ است .

2)ديواره ي سياهرگ ضخيم تر و داراي خاصيت ارتجاعي بيش تر از سرخرگ است .                           3) ديواره ي سرخرگ ضخيم تر و ديواره ي سياهرگ خاصيت ارتجاعي بيش تر دارد .                    4)ديواره ي سياهرگ ضخيم تر و ديواره ي سرخرگ خاصيت ارتجاعي بيش تر دارد .

28-   نوع خون را به ترتيب در سرخرگ شكمي و سرخرگ پشتي ماهي مشخص نماييد .

1) خون روشن -  خون روشن               2) خون تيره -  خون تيره                                                3) خون روشن -  خون تيره                  4) خون تيره -  خون روشن

29- جهت قوس آئورت و نوك قلب به كدام سمت بدن است ؟

1) چپ – راست                                2) راست – چپ                                        

3) راست – راست                             4) چپ - چپ

30- كدام اندام بدن رگ ورودي و رگ خروجي آن سياهرگ است ؟                                                   1) معده               2) پانكراس            3) مغز                 4) كبد
31-  شخصي به علت فقدان كيسه ي صفرا داراي رژيم فاقد چربي است . احتمال بروز كدام عارضه در او بيش تر است ؟

1)لاغري مفرط       2) خرابي پوست         3) كاهش انرژي بدن          4) پايين آمدن درجه ي حرارت

32- كدام يك از اندام يا بخش هاي زير در سمت راست شكم قرار دارند ؟

1)روده ي كور و طحال                       2) راست روده و طحال        

3) پيلور و آپانديس                             4) كبد و كولون پايين رو 

33- روده ي بزرگ به علت .................... چين خورده ديده مي شود ولي روده ي كوچك چنين نيست 1)كوتاه بودن طول روده نسبت به طول ماهيچه ي طولي

2)كوتاه بودن طول ماهيچه ي طولي نسبت به كل روده

3)  داشتن حركات دودي

4) داشتن حركات موضعي

 34- در اندام كليه خون كدام يك از رگ هاي زير مواد دفعي كم تري دارد ؟

1) سرخرگ كليوي               

 2) شبكه ي اول مویرگي                                   

 3) سياهرگ كليوي                     

 4) سرخرگ آوران گلومرولي

35- هنگام دياليز به ترتيب خون از طريق كدام رگ وارد كليه ي مصنوعي مي شود و از طريق چه رگي به بدن باز مي گردد ؟

1)    سرخرگ – سرخرگ                 2)  سياهرگ – سياهرگ       

3) سرخرگ - سياهرگ                  4) سياهرگ – سرخرگ

36- به طور عمده هرم هاي كليه شامل كدام لوله هاست ؟

1)    پيچ خورده ي دور و جمع كننده               2)جمع كننده و هنله

 3) پيچ خورده ي دور ، نزديك و هنله            4) جمع كننده ، هنله و پيچ خورده ي دور

37- در تخليه ي طبيعي ادرار ترتيب مراحل زير چگونه است ؟

الف- باز شدن اسفنگتر صاف حلقوي                 ب- تحريك گيرنده هاي كششي مثانه

ج- دستور باز شدن اسفنگتر از نخاع                  د- رسيدن پيام هاي عصبي از مخ به ماهيچه هاي مخطط

1)ب،ج،الف،د               2)ب،د،ج،الف          3)ب،ج،د،الف             4)ج،ب،الف،د

38- ديواره داخلي تراكئيد و ديواره­هاي آوندهاي آب­كشي به ترتيب از كدام مواد هستند؟

1)چوب­پنبه                                 2) سوبرين و ليگنين

3) ليگنين و سلولز                        4) سلولز و سوبرين

39- كدام بخش پانكراس قوي­ترين آنزيم­هاي گوارشي را ترشح و در كدام بخش لوله­ي گوارش وارد مي­كند؟

1)    برون ريز- انتهاي دوازدهه               2) درون­ريز- ابتداي معده 

3) درون­ريز- انتهاي معده                     4) برون­ريز- ابتداي دوازدهه

40- بيش­ترين تعداد عناصر سلولي خون، در كجا ساخته مي­شود؟

1) مغز استخوان             2) كبد             3) طحال           4) گره­هاي لنفي

 
 
                                                                                                    موفق و پيروز باشيد

 

     گزينه

سوال

1

2

3

4

1

 

ü       

 

 

2

 

 

ü       

 

3

 

 

ü       

 

4

ü       

 

 

 

5

ü       

 

 

 

6

 

 

 

ü       

7

 

 

ü       

 

8

ü       

 

 

 

9

 

ü       

 

 

10

 

ü       

 

 

11

 

ü       

 

 

12

 

 

ü       

 

13

 

 

 

ü       

14

 

ü       

 

 

15

ü       

 

 

 

16

 

 

 

ü       

17

 

 

ü       

 

18

ü       

 

 

 

19

 

ü       

 

 

20

 

ü       

 

 

21

 

 

ü       

 

22

ü       

 

 

 

23

 

ü       

 

 

24

 

ü       

 

 

25

 

 

 

ü       

26

 

 

ü       

 

27

ü       

 

 

 

28

 

 

 

ü       

29

 

 

 

ü       

30

 

 

 

ü       

31

 

 

ü       

 

32

 

 

ü       

 

33

 

ü       

 

 

34

 

 

ü       

 

35

 

ü       

 

 

36

 

ü       

 

 

37

ü       

 

 

 

38

 

 

ü       

 

39

 

 

 

ü       

40

ü       

 

 

 

 

 

 

 

 

 

 

+ نوشته شده در  چهارشنبه بیست و چهارم فروردین 1390ساعت 20:30  توسط مهناز نسیمی  | 

سوالات برگزیده خرداد 89 همکاران گروه زیست شناسی شهرستان گرمسار

 سوالات زیست و آزمایشگاه ۱

۱)به سوالات تستی زیر پاسخ دهید:

۱- کدام اندامک در افزایش مساحت غشاهای درون سلول نقش دارد

1 لیزوزوم   2- ریبوزوم   3- سانتریول     4- اسکلت سلولی

۲- در تخمدان ها به علت تولید هورمونهای استروئیدی کدام اندامک گسترش زیادی پیدا کرده است

1- شبکه آندوپلاسمی زبر   2- شبکه آندوپلاسمی صاف    3- جسم گلزی   4- میتوکندری

۳- در مقطع عرضی ریشه جوان کدام بخش درونی­تر است

1- پوست  2- آندودرم    3- دایره محیطیه   4- آوند آبکش

۴- کدام اندامک در تمایز اندامهای جنینی نقش موثرتری دارد

1- واکوئل   2- میتوکندری   3- لیزوزوم   4- شبکه آندوپلاسمی

۵- پس از تحریک کدام یک از سلولهای زیر دیرتر به حداکثر انقباض خود می­رسند

1- ماهیچه­های زبان               2  - ماهیچه­های سه سر بازو   

 3- ماهیچه چهار سر ران       4- ماهیچه جدار آئورت

۶- قسمتی از معده گاو که به روده متصل می­شود چه نام دارد

1- سیرابی   2- هزارلا    3- شیردان    4- نگاری

۷- مهمترین عمل صفرا کدام است

1- ضدعفونی کردن معده               2- کمک به هضم لیپیدها 

 3- کمک به هضم پروتئینها           4- اسیدی کردن روده

 ۲) به سوالات زیر پاسخ کوتاه دهید:

1- زردپی آشیل مربوط به کدام ماهیچه در پا است

۲- هر جمله مربوط به کدام سلول خونی است

الف- ماکروفازها از تغییر و تکامل این سلول حاصل می­شود 

ب- اریتروپویتین تولید این سلول  را تنظیم می­کند

 ۳)صحیح یا غلط بودن جمله زیر را با علامت ص یا غلط مشخص کنید:

اسیدهای نوکلئیک به وسیله­ی واکنش سنتز آبدهی به نوکلئوتید تبدیل می­شوند.

 ۴) برای هر کدام از موارد زیر دلیل علمی بیاورید

الف- زیاد بودن تعداد گلبول قرمز مردم مناطق کوهستانی

ب) مجاری تنفسی ما همیشه باز هستند

سوالات علوم زیستی و بهداشت

 ۱- صحیح یا غلط بودن جملات زیر را با علامت ص یا غ مشخص کنید

الف- بخش مهم غشای پلاسمایی سلول های پنبه را لیپید تشکیل می­دهد

ب- ما می­توانیم به کمک اندام های حسی دنیای پیرامون خود را کاملا درست درک کنیم

پ- ملکول هموگلوبین از تعداد زیادی اسیدآمینه ساخته شده است

ت- آزمایشهای ردی بر روی گوشت در جهت باطل کردن نظریه­ی خلق الساعه بود

 ۲- در ساختمان یک اکوسیستم چند گروه جاندار مشاهده می­شود و قارچ ها جزء کدام گروهند

1- 3گروه- تجزیه کننده                    2- 4گروه- مصرف کننده  

 3- 3گروه- تولیدکننده                     4- 5گروه- تجزیه کننده

 ۳- زیر کلمات درست داخل پرانتز خط بکشید

لیپید بخش مهمی از ( دیواره سلولی – غشاهای سلولی) است.

 چرا دوقلوهای یکسان گروه خونی مشابه دارند

 

 

+ نوشته شده در  پنجشنبه سیزدهم آبان 1389ساعت 10:36  توسط مهناز نسیمی  | 

سوالات مسابقه آزمایشگاهی عملی و تئوری سال 1389 شهرستان گرمسار

آزمون تئوری

۱- انعکاس تخلیه مثانه توسط کدام یک از مراکز عصبی زیر فعال می­شود؟

1- نخاع                               2- بصل­النخاع                     

3- تالاموس                         4- مخ

2- بازجذب کدام مورد زیر در لوله نفرونی صورت نمی­گیرد؟

1- اوره                               2- گلوکز                            

3- اسید­آمینه                      4- بیکربنات

3- خونی که از کلیه انسان خارج می­شود ابتدا از کدام دریچه می­گذرد؟

1- سه لختی                         2- دولختی                          

3- سینی آئورتی                   4- سینی ششی

4- رباط و مایع مفصلی بین کدام دو استخوان وجود ندارد؟

1- ران و درشت ­نی              2- ران و نازک­ نی                  

 3 - بازو و کتف                    4- ران و لگن

5-کدام بافت سلولهای کوتاه و منشعب دارد؟

1- عناصرآوندی                   2- تراکئید                           

 3- فیبر                               4- اسکلرئید

6- حجم کدام یک در چشم انسان بیشتر است؟

1- زجاجیه                           2- زلالیه                         

 3- قرنیه                             4- عدسی

7-کدام یک در شکست نور وارد شده به چشم بی­اثر است؟

1- زجاجیه                          2- عدسی                      

 3- قرنیه                              4- مردمک

8- در ماهی کدام باله به توقف ماهی کمک می­کند؟

1- دمی                              2- سینه­ای                           

 3- مخرجی                         4 - پشتی

9-آندوسپرم بازدانگان و اندوخته نهاندانگان در چه مرحله­ای تشکیل می­شوند؟

1- بعد از لقاح – همزمان با تشکیل رویان                                   

 2- بعد از لقاح – قبل از لقاح

3- فبل از لقاح – بعد از لقاح                            

4- همزمان با تشکیل رویان – بعد از لقاح

10-کدام عبارت صحیح است؟

1- در پیرچشمی، عدسی چشم انعطاف­پذیرتر می­شود   

2- در آستیگماتیسم، پرتوهای نور در یک نقطه، متمرکز نمی­شوند

3- در دوربینی قطر کره­ی چشم، زیادتر از حد معمول است   

4- در نزدیک ­بینی، تصویر اشیای دور در پشت شبکیه تشکیل  می­شود

11-کدام یک از مشخصات سیستم عصبی پشه است؟

1- اجتماع کلیه­ی گره های عصبی در مغز                  

 2- دو طناب عصبی موازی

3- وجود گره­های عصبی در طول بدن         

 4- شبکه­ای از رشته­های عصبی

12- محتویات دومین شبکه­­ی مویرگی کلیه وارد کدام رگ می­گردد؟

1- بزرگ سیاهرگ زبرین                                        

2- سیاهرگ باب و بزرگ سیاهرگ زیرین

3- سیاهرگ باب         

4- بزرگ سیاهرگ زیرین

13-کدام بخش فاقد عصب است؟

1- مردمک                         2- نقطه­ی کور              

3- عنبیه                            4- ماهیچه مژکی

14- کدام فاقد همولنف است؟

1- ملخ        2- عنکبوت         3- خرچنگ دراز                4- کرم خاکی

15- در نخاع ........ به طور کلی فاقد میلین است؟

1- آکسون نورون حسی                            2- آکسون نورون حرکتی

3- دندریت نورون حسی                           4- دندریت نورون حرکتی

16- در ذرت کدامیک حاصل مستقیم میتوز است؟

1- هاگ ماده                      2- آنتروزوئید                                  

3- دانه گرده نارس             4- تخم اصلی

17- در انسان کاهش بیمار گونه کدام بخش در بروز خیز نقش دارد؟

1- قشری فوق کلیه              2- مرکزی فوق کلیه       

3- درون­ریز پانکراس               4- پسین هیپوفیز

18- کدام ماهیچه در مجاورت درشت­نی قرار گرفته است؟

1- خیاطه                           2- سرینی                

3- دوسر                                 4- توام

19- سلولهای کدام گیاه سانتریول دارد؟

1- آزولا          2- اقاقیا               3- لادن                 4- عشقه

20- بطور معمول پلاسمای خون انسان سالم فاقد کدام است؟

1- پروترومبین                           2- اریتروپویتین             

 3- گاماگلوبولین                       4- هموگلوبین

21- منشا قرنیه در چشم از چه بافتی است؟

1- پوششی                             2- پیوندی         

3- عصبی                                4- عضلانی

22- اگر در زير ميكروسكوپ اندازه ي واقعي يك نمونه 100 ميكرون و اندازه ي تصوير 80 ميلي متر باشد كدام يك مقياس آن است؟ 

1-800 /1            2-80 /1            3- 20/1                    4- 40/1

23- كم بودن ضخامت منطقه پوست وقرار گرفتن دسته آوندهاي چوب-آبكش روي چند دايره ي متحد المركز ويژگي كدام گياه است؟

1- لوبيا               2- ذرت                3- كاج                     4- ماش

24-انقياض در كدام يك سريع تر صورت مي گيرد؟

1- ديواره ي مري                  2 - ديواره ي معده        

 3- ديواره ي رگ                   4- ديافراگم

25- اگر رگ لنفي تنه دچار آسيب شود اختلال در جذب كدام ماده رخ مي دهد؟

1-ویتامینk                          

۲ - ويتامينB1                       

۳- ویتامین c               

۴- ویتامین B12

26-چينه دان و سنگدان جزء كدام بخش از دستگاه گوارشي است؟ 

1- مري و مري                       2- مري ومعده          

 3- معده و معده                    4- معده و مري

27- در هنگام كهير كدام يك افزايش مي يابد ؟ 

1- لنفوسيت                  2- ائوزينوفيل         

3- نوترفيل                        4-ائوزينوفيل ولنفوسيت

28- فعاليت هاي تعقلي منجر به استنتاج منطقي و ادراك از وظايف كدام بخش دستگاه عصبي است؟

1- بصل النخاع       2- مخچه          3- هيپوتالاموس             4- مخ

29-كدام نوع سلول گيرنده عمدتاً مسئول بينايي در نور كم است و كدام نوع نسبت به نور حساسيت كمي دارد؟

1- استوانه اي ها – استوانه اي ها                 

 2- استوانه اي ها – مخروطي ها    

3- مخروطي ها – مخروطي ها              

 4- مخروطي ها – استوانه اي

30- از بين رفتن كدام يك باعث كري كامل مي شود؟

1- پرده صماخ                                2- استخوان هاي گوش مياني     

3- مجاري نيم دايره                       4- حلزون

31-دست و پاي بعضي از افراد تكان ها و لرزش هاي غير قابل كنترلي دارد صرف نظر از دلايل پزشكي مختلف با اطلاعاتي كه درباره ي هورمون ها داريد اين عارضه را به كدام يك از موارد زير ربط مي دهيد؟

1- كمبود هورمون غده تيروئيد               

 2- افزايش كورتيزول 

3- كمبود هورمون غده ي پاراتيروئيد      

 4- افزايش آلدوسترون   

32- کدام مورد درباره ی غضروف نای و نايژه و نايژک صحيح است؟

۱- نای غضروف کامل ـ نايژه غضروف نيم دايره ـ نايژک غضروف منقطع دارد.

۲- نای غضروف کامل ـ نايژه غضروف منقطع ـ نايژک پيوسته غضروف است.

۳- نای غضروف نيم دايره ـ نايژه غضروف منقطع ـ‌نايژک بدون غضروف است.

۴- نای غضروف نيم دايره ـ‌نايژه و نايژک غضروف منقطع دارند.

33- کدام يک از جملات زير صحيح می باشد:

۱- حد تفکيک و قدرت جداسازی ميکروسکوپ نوری از ميکروسکوپ الکترونی بيشتر است.

۲- قدرت جداسازی ميکروسکوپ الکترونی کم تر از ميکروسکوپ نوری است.

۳- حد تفکيک ميکروسکوپ الکترونی کم تر از ميکروسکوپ نوری است.

۴- حد تفکيک و قدرت جداسازی ميکروسکوپ الکترونی کم تر از نوری است.

34- غده هيپوفيز بر روی کدام يک از استخوان های جمجمه قرار دارد؟

۱- پس سری                                              ۲- پروانه ای

۳- پرويزنی                                                ۴- آهيانه

35- در ساختمان داخلی بدن انسان طحال نسبت به کدام يک فاصله بيشتری دارد؟

۱-‌کيسه صفرا         ۲- پانکراس          ۳- آپانديس             ۴- معده

36- در زير ميکروسکوپ در يک مقطع ميکروسکوپی گياهی استوانه مرکزی بزرگ ضخامت پوست ناچيز آوند های چوبی و آبکش منطبق بر هم مشاهده مي­گردد. اين مقطع متعلق به کدام بخش گياه است؟

۱- ريشه                 ۲- ساقه                 ۳- برگ               ۴- رگبرگ

37- کدام ماهچه در مجاورت ماهیچه دلتایی قرار دارد؟

1- جناغی ترقوه ای پستانی                         2- راست شکمی       

3- پشتی بزرگ                                            4- ذوزنقه ای

38- کار رشته های ارتجاعی که به لبه های لت های دریچه های دریچه دولختی و سه لختی قلب متصل اند چیست؟

1- بستن دریچه ها                 

2- بازکردن دریچه ها

3- جلوگیری از بیرون زدگی دریچه ها به سمت دهلیز ها

4- جلوگیری از فرورفتگی دریچه ها به سمت بطن ها

39- هنگام نزدیک شدن استخوان ساعد به استخوان بازو به ترتیب کدام ماهیچه منقبض و کدام ماهیچه در حال استراحت است؟

1- دوسر ،سه سر                                          2 - سه سر ،دو سر

3- سه سر، چهارسر                                      4- چهار سر، سه سر

40- شخصی ابتدا یک دم عمیق انجام داده سپس سعی می کند تا آنچه که می تواند هوای داخل شش های خود را در یک بادکنک وارد نماید. هوایی که وارد بادکنک می شود نشان دهنده کدام حجم تنفسی است؟

1- هوای ذخیره دمی                                 2- هوای ذخبره باردمی

3- ظرفیت حیاتی                                       4- ظرفیت کل ششی

 

1-1               10-2               19-1             28-4            ۳۷-۴            

2-1              11-3               20-4              29- 2           ۳۸-۳          

3-1              12-4               21-2              30-4            ۳۹-۱           

4-2             13-1                22-1              31-3           ۴۰-۳             

5-4             14-4                23-2              32-3

6-1             15-4                24-4              33- 3

7-4             16-2                25-1              34-2

8-2             17-1                26-1              35-3

9-3            18-4                 27-4              36 -2

                                               

 آزمون عملی

 ایستگاه شماره 1 (10                                                                           

درنیم تنه انسان شماره­های مشخص شده را نام­گذاری کنید:

1-                            2-                      3-                           4 -                             

در ماهیچه انسان شماره­های مشخص شده را نام­گذاری کنید:

5-                                           6-

 در مولاژ گوش شماره­ مشخص شده را نام­گذاری کنید:

7-                            

در مولاژ مغز شماره­های مشخص شده را نام­گذاری کنید:

8-                                         9-                                       10-

 

ایستگاه شماره 2 (10 امتیاز)

الف- در ماکت گیاهی روبرو شماره­های مشخص شده را نام­گذاری کنید:

1-                        2-                             3-                              4 -

ب- از میان گیاهان موجود(جعفری، تره،گل رز، گل یاس، شوید، گندم)

1-کدام جزء گیاهان تک لپه به شمار می­رود:

2- کدام جزء گیاهان دو ساله به شمار می­رود:

3- از بین گیاهان موجود کدام موردها هم تکثیر جنسی داشته و هم تکثیر غیرجنسی:

 

ایستگاه شماره 3(10 امتیاز هر مورد 1 امتیاز)

 شماره­های مشخص شده  در میکروسکوپ را نام­گذاری کنید:

1-                                   ۲-                                                                                                                           2

 در ماکت شماره 3

الف- کدام مرحله تقسیم میوز را نشان می­دهد؟

ب- تعداد کروموزوم­ها در سلول فوق را مشخص کنید؟

 در ماکت شماره 4

 الف- سلول جانوری است یا گیاهی؟

ب- کدام مرحله تقسیم میتوز را نشان می­دهد؟

 در مولکول DNA روبرو شماره مشخص شده  را نام­گذاری کنید:

5-

 دراسکلت انسان شماره­های مشخص شده را نام­گذاری کنید:                                                                                 

6-                                     7-                                    8-                                   

ایستگاه شماره 4(10 امتیاز هر مورد 1 امتیاز)

الف- درقلب تشریح شده روبرو سوزن­های مشخص شده را نام گذاری کنید

سوزن قرمز                          سوزن زرد                       سوزن آبی                                 

ب- درکلیه تشریح شده روبرو سوزن­های مشخص شده را نام گذاری کنید

سوزن قرمز                         سوزن زرد                       سوزن آبی                                                 

پ- درچشم تشریح شده روبرو سوزن­های مشخص شده را نام گذاری کنید

سوزن قرمز                           سوزن زرد            

سوزن آبی                             سوزن سفید                               

 ایستگاه شماره 5 (5 امتیاز)

الف- آزمایشی طراحی کنید که نشان دهنده خروج آب از گیاه (عمل تعرق)می­باشد؟(3 امتیاز)

    

ب- سن درخت را در تصویر مقابل تعیین کنید؟(2 امتیاز)

 

ایستگاه شماره 6(10 امتیاز)

الف- از نمونه گیاهی(تره) اپیدرم تهیه کنید)5 امتیاز)

ب- پس از تهیه نمونه وتنظیم نمونه­ در زیر میکروسکوپ با بزرگنمایی(10× عدسی شیئی)

تصویری از نمونه را در دایره روبرو رسم نمائید(3 امتیاز)

 پ- با توجه به قسمت ب سوال بزرگنمایی کل میکروسکوپ را محاسبه نمائید: (2 امتیاز)

 

ایستگاه شماره 7 (12 امتیاز هر مورد 3 امتیاز)                                                                               

اسلایدهای شماره­گذاری شده را در زیر میکروسکوپ قرار داده و آنها را شناسایی کنید:

۱-              ۲-                   ۳-                 ۴- 

ایستگاه شماره 8(10 امتیاز)

 با استفاده از وسایل موجود دستگاه تنفس پرنده را مدل­سازی کنید:)چسب، بادکنک، نی نوشابه)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

+ نوشته شده در  دوشنبه سی ام فروردین 1389ساعت 9:28  توسط مهناز نسیمی  | 

نمونه سوالات برگزیده دی ماه 1388 همکاران زیست شناسی شهرستان گرمسار

زیست­شناسی و آزمایشگاه 2(دی ماه 1388)

1-     گزینه صحیح را مشخص کنید:

الف- کدام یک از گیرنده­های حسی موجود در پوست فاقد پوششی از بافت پیوندی می­باشد؟

1- گیرنده درد    2- گیرنده گرما      3- گیرنده فشار        4- گیرنده لمس

ب- نورونهای حرکتی اعصاب پیکری کدامیک از ماهیچه­های زیر را تحریک می­کند؟

1- ماهیچه­های قلب و عروق          2- ماهیچه­های دستگاه گوارش

3- ماهیچه­های دستگاه ادراری        4- ماهیچه­های اسکلتی  

پ- برای جلوگیری از پس زدن اعضا در افراد مصرف کدام یک را به افراد گیرنده­ی عضو پیشنهاد می­کنید؟

1- پادتن        2- اینترفرون      3- آلدوسترون       4- کورتیزول

۲- چرا لوب­های بویایی ماهی در مقایسه با لوبهای بویایی مغز انسان بزرگتر است؟

۳- درستی و یا نادرستی هر یک از عبارتهای زیر را مشخص کنید:

الف- انسولین عاملی است که می­تواند در سلولهای ماهیچه­ای انرژی را افزایش دهد.

ب- در هر سلول پیکری شامپانزه در مرحله­ی پروفاز میتوز 48 مولکولDNA   وجود دارد.

پ- در هر سلول پیکری انسان در مرحله­ی متافاز میتوز 92 مولکول DNA وجود دارد.

 

 زیست­شناسی و آزمایشگاه 1(دی ماه 1388)

1- گزینه صحیح را مشخص کنید:

الف-  درکدام اندامک RNA نقش ساختاری دارد؟

1- هسته                     2- ریبوزوم            3- میتوکندری        4- کلروپلاست

ب- آزاد شدن کدام یون از شبکه آندوپلاسمی ماهیچه­های مخطط باعث شروع انقباض می­شود؟

1- فسفر                     2- کلر                  3- سدیم               4- کلسیم

پ- در صورت بالا رفتن غلظت آب اکسیژنه در سلول کدام اندامک خطر آن را از بین می­برد؟

1- پراکسیزوم      2- لیزوزوم            3- ریبوزوم          4- شبکه آندوپلاسمی

ت- ارتباط دو سلول گیاهی مجاور بیشتر به وسیله کدام است؟

1- غشاء پلاسمایی    2- پلاسمودسم      3- دیواره اولیه       4- دیواره ثانویه

ج- از درون ماتریکس تا بیرون سلول چند لایه فسفولیپید وجود دارد؟

1- 2 لایه                  2-4 لایه                3- 6 لایه               4- 8 لایه

2- درستی و یا نادرستی هر یک از عبارتهای زیر را مشخص کنید:

الف- سلولهای کلانشیم قدرت انجام میتوز دارند.

ب- ویژگی غشای موکوزی داشتن سلولهای مژکدار است.

پ- سلولهای کرک و نگهبان روزنه متعلق به بافت زمینه ای اند.

2- جملات زیر را با قرار دادن کلمات مناسب کامل کنید:

الف- بین مونومرهای کازئین پیوند ............ وجود دارد.

ب- واکنش­های متابولیسمی مورد نیاز لوله­های غربالی در سلول ............ انجام می­شود.

پ- گاسترین و سکرتین به ترتیب ph لوله ی گوارش را ......... و ...............

می دهند.

 

 

علوم زیستی و بهداشت(دی ماه 1388)

1-     کروموزوم در چه قسمتی از سلول قرار دارد؟

2-     هر یک از فعالیتهای زیر توسط چه بخش یا اندامک سلولی انجام می­شود؟

الف- گوارش میکروبها ............

3-     گزینه صحیح را مشخص کنید:

الف- کدام عنصر در ساختار هیدراتهای کربن وجود ندارد؟

1- اکسیژن        2- کربن         3- نیتروژن         4- هیدروژن

ب- سطح خارجی کدام سلولها با کوتین پوشیده شده است؟

۱- آوند چوبی    ۲- روپوست      ۳ آوند آبکشی      ۴- میان برگ

4- درستی و یا نادرستی هر یک از عبارتهای زیر را مشخص کنید:

الف- ماده­ی قرمز رنگ موجود در سلولهای ریشه­ی چغندر در ریبوزوم قرار دارد.

5- زیست­شناسان در تلاش برای یافتن گیاهانی هستند که بیشتر از گیاهان دیگر انرژی نورانی خورشید را برای ماده­سازی به کار می­برند اگر موفق شوند:

الف- این کار چه اهمیتی برای انسانها دارد؟

ب- این کار جزء کدام شاخه از علوم زیستی می­باشد؟

6- هیدرات کربن اضافی در هر یک از سلولهای زیر به چه صورتی ذخیره می­شود؟

الف- سلول ماهیچه کودک         ب- سلول ساقه نیشکر        پ- سلول گیاه سیب­زمینی

 ۷- علت مورد زیر را بنویسید:

الف-  چرا سیب زمینی را در کیسه های سیاه نگهداری می کنند.

+ نوشته شده در  دوشنبه نوزدهم بهمن 1388ساعت 12:51  توسط مهناز نسیمی  | 

نمونه سوال زیست و آزمایشگاه1

1– مواد حاصل از گوارش سلولز در کدام قسمت لوله گوارش جانوران گياهخوار جذب مي شود؟

الف ) روده باريک و روده بزرگ         ب) روده باريک و روده کور
ج) روده بزرگ و روده کور                د) روده بزرگ و سيرابي  

  2 – کدام هورمون بر ترشح بيکربنات شيره پانکراس تأثير دارد؟

الف ) موسين          ب) پيتالين           ج) گاسترين            د) سکرتين  

  3 – اسيدهاي آمينه به چه روشي در روده باريک جذب مي شوند؟

الف) انتشار      ب) انتشار تسهيل شده       ج) انتقال فعال          د) رگ هاي لنفي


4 – ماهيچه هاي کدام قسمت لوله گوارش از نوع صاف است؟
الف) راست روده            ب) حلق                ج) مخرج               د) دهان


5 – پوشش داخلي معده و روده در کدام نوع بافت پوششي است.
الف) سنگفرشي يک لايه                      ب) سنگفرشي چند لايه
ج) استوانه اي يک لايه                          د) استوانه اي چند لايه  

6- غلظت یک ماده در یک نوع مشخص از سلولهای خونی، بیشتر از غلظت این ماده در پلاسمای اطراف آن می باشد. با این حال این        ماده به حرکت خود به داخل سلول ادامه می دهد. فرآیندی که بوسیله آن این ماده وارد سلول می شود چه نام دارد؟

 الف) اسمز           ب) انتشار ساده             ج) انتشار تسهیل شده                  د) انتقال فعال

7- کدام دسته از مواد زیر می توانند به روش آندوسیتوز و اگزوسیتوز ازغشاء سلولی عبور کنند؟

 الف) پروتئین ها، اسیدهای آمینه، مونوساکاریدها        ب) پلی ساکاریدها، منوساکاریدها،آب

 ج) قطرات روغن،آب ، یونها                                 د) پروتئین ها،قطرات روغن ، پلی ساکاریدها

 8- اگریک سلول گیاهی تورژسانس یافته را در شیره سلولی همان سلول که قبل از تورژسانس استخراج شده است قرار دهیم، برای آن سلول چه اتفاقی میافتد؟  

الف) تغییری نمی کند        ب) آب از دست می دهد        ج) آب جذب میکند         د) می ترکد

9- کدامیک از مولکول های زیر، در ساختار کلروپلاست یافت نمی شود؟

الف) نشاسته               ب) پروتئین                ج) سلولز                   د) فسفو لیپید

+ نوشته شده در  دوشنبه بیست و سوم آذر 1388ساعت 12:5  توسط مهناز نسیمی  | 

نمونه سوالات تستی زیست پیش دانشگاهی

سوالات تستی مربوط به فصل اول تا صفحه 50 کتاب پیش دانشگاهی 1

1-     در تریکودینا محصول فعالیت کدام آنزیم دارای آنتی کون آغاز است؟

1- RNAپلیمراز II             پلیمرازIII -3              RNAپلیمرازRNA   4-               RNAپلیمراز پروکاریوتی           

2- کدام در مورد ملکول tRNA نادرست است؟

1- tRNA آعازگر فقط در جایگاه P قرار می­گیرد                       2- توسط دو حلقه­ی خود روی ریبوزوم نگهداری می­شود

3- ساختار سه بعدی آن در سلول شبیه برگ گیاه شبدر است           4- همه­ی آمینواسیدها به نوکلئوتید آدنین­دار tRNA  متصل می­شوند

3- منومر سازنده­ی کدامیک از عواملی که در رونویسی نقش دارند با سایرین متفاوت است؟

1- عامل رونویسی        2- فعال کننده               3- RNAپلیمراز                4- توالی افزاینده

4- اتصال پروتئین تنظیم کننده به کدام به ترتیب سبب روشن و خاموش شدن اپران لک می­گردد؟

1- اپراتور- آلولاکتوز                                   2- آلولاکتوز-  راه­انداز

3- عامل تنظیم کننده- اپراتور                           4- اپراتور- عامل تنظیم کننده

5- در مهندسی ژنتیک در مرحله­ی ساختن DNA نوترکیب استفاده از کدام آنزیم مقدم­تر است؟

1- محدود کننده­ی  DNA           ECORI لیگاز              3- هلیکاز              4- آنزیم RNA پلیمراز

6- اگر در حین ترجمه­ی یک mRNA مفروض 93 رمز از جایگاه A به P انتقال یابد رشته پلی­پپتید تحت رهبری این ملکول  mRNA            چند پیوند پپتیدی خواهد داشت؟

1-93                          2- 92                         3- 94                             4- 95

7- توالی رشته­ی الگوی سازنده­ی ضد رمز GAU کدام است؟

1- CTA -۴             GUA-۳            CUA -۲                                   GTA

8- ملکول RNA با این ترتیب UCUCUCUCU ساخته می­شود با توجه به این که این ملکول در شرایط مناسب برای ساختن       پروتئین در لوله آزمایش قرار می­گیرد حکم صحیح را انتخاب کنید.

1- دو نوع زنجیره پلی­پپتیدی ساخته می­شود که هر کدام فقط دارای یک اسیدآمینه است

2- دو نوع زنجیره پلی­پپتیدی ساخته می­شود که هر کدام دارای سه اسیدآمینه است

3- یک نوع زنجیره پلی­پپتیدی ساخته می­شود که در آن دو نوع اسیدآمینه و یک در میان قرار دارد.

4- یک نوع زنجیره پلی­پپتیدی ساخته می­شود که در آن سه نوع اسیدآمینه وجود دارد.

9- برای توالی قابل ترجمه­ای به صورت TGA بر روی DNA آنتی­کدون متناسب بر روی tRNA کدام است؟

     UGA-۴                TGA- ۳           AGUَ - ۲            ACU- ۱

10- با ایجاد جهش در کپک نورسپوراکراسا ابتدا سنتز کدام یک دچار اشکال می­شود؟

1- برخی آنزیم­ها       2- برخی اسیدهای آمینه          3- تیامین                       4- نیاسین

11- در هنگام ترجمه­ی mRNA زیر هرگاه GGC  به عنوان یک آنتی­کدون در جایگاه A ریبوزوم قرار گرفته باشد کدام کدون در جایگاه P قرار دارد؟           AUGCCGGGCUAC                                                               

1- UAC                  2-GGC                        3- AUG                         4- CCG

12- در RNAهای پیک بالغ یوکاریوتی فقط قسمت­هایی از رونوشت......................

1- اگزون­ها و همه اینترون­ها ترجمه نمی­شوند                    2- اینترون­ها و همه اگزون­ها حذف شده است

3- اینترون­ها ترجمه نمی­شوند                                       4- اگزون­ها و همه اینترون­ها حفظ شده است

13- پیوند بین آخرین tRNA و پلی­پپتید ساخته شده در جایگاه ............. ریبوزوم توسط ............. شکسته می­شود

1- جایگاه RNA-P پلیمراز                                        2- جایگاه-P عامل پایان ترجمه

3- جایگاهA RNA- پلیمراز                                       4-جایگاه A- عامل پایان ترجمه

14- تبدیل mRNA اولیه با سه رونوشت اینترونی به mRNA بالغ در ............. با برقراری .............. پیوند فسفودی استر صورت می­گیرد

1- هسته – 3            2- سیتوپلاسم – 3              3- سیتوپلاسم – 4                    4- هسته – 4  

 15- کدام بیان در مورد DNA  پلازمید صحیح است؟

1- تک رشته­ای فاقد جایگاه آغاز رونویسی                   

 2- تک رشته­ای دارای جایگاه آغاز رونویسی  

3- دو رشته­ای فاقد جایگاه آغاز همانندسازی                 

 4- دو رشته­ای داری آغازهمانندسازی                   

16- در اپران لک چند توالی ساختاری و چند توالی تنظیمی می­توان یافت؟

1- 1و3                        2-3و2                          3- 3و1                        4- 2و3

17- در ژن زیر کدام جهش نقطه­ای تاثیر بیشتری در بروز صفت ایجاد می­کند؟

DNA…AAATACTTTACAGGGCCCATCATT   

mRNA    UUUAUGAAAUGUCCCGGGUAGUAA 

1-  TACT  ...... ... .....        TACTT                              2- ACG ..........  ACA

3- ATTT ........     ATCATT                        4- GCC   ............   GGGCCC

18- جهش در کدام سلول نمی­تواند به نسل بعد منتقل شود؟

1- آنتروزوئید         2- اسپرماتوزوئید       3- تخم تریپلوئید گیاهان          4- تخم دیپلوئید گیاهان

19- در ویروس آبله گاوی که با روش مهندسی ژنتیک ژن ویروس هرپس تناسلی را دریافت کرده کدام وجود ندارد؟

1- DNA حلقوی     2- پروتئین سطحی هرپس     3- پروتئین سطحی آبله       4- DNA نوترکیب

20- در اپران لک پس از اتصال آلولاکتوز به پروتئین تنظیم کننده ............

1- سه ملکول RNA ساخته می­شود                    2-یک ملکول RNA ساخته می­شود                   

3- مهارکننده بر اپراتور قرار می­گیرد                    4- مسیر حرکتRNA  پلیمراز مسدود می­شود

+ نوشته شده در  دوشنبه چهارم آبان 1388ساعت 13:16  توسط مهناز نسیمی  | 

نمونه سوالات خرداد شهرستان گرمسار

نمونه سوالات زیست و آزمایشگاه 1(خرداد88)

1-    درست یا نادرست بودن جملات زیر را مشخص کنید:

الف- در همه­ی باکتری­ها اطراف غشای پلاسمایی دیواره­ی سلولی وجود دارد.

ب- در تخمدان­ها به علت هورمون­های استروئیدی شبکه­ی آندوپلاسمی زبر(دانه­دار) گسترش زیادی دارد.

 


ادامه مطلب
+ نوشته شده در  دوشنبه بیستم مهر 1388ساعت 8:13  توسط مهناز نسیمی  | 

سوالات مسابقات آزمایشگاهی زیست شناسی شهرستان گرمسار

توجه : پاسخ نادرست نمره ی منفی دارد .

تهیه وتنظیم سوالات توسط:

مهناز نسیمی - نسرین فرجی - حمیدرضا جعفری

 نام ونام­خانوادگی:                                                            نام دبیرستان:

                                                                                            جمع کل امتیاز:30

 1- براي شروع كار با ميكروسكوپ ، بهتر است از كدام عدسي شيئ استفاده نمائيم؟

1) 4                                 2) 10                           3) 40                          4)  100
2- چنانچه در آزمايش تعیین گروه خوني ، خون فرد با آنتي كرهاي D (ضدRH) و A رسوب داده باشد، گره خوني فرد كدام است ؟  

  1) A-                                 2) A+                            3) +B                                 4)  B

 


ادامه مطلب
+ نوشته شده در  یکشنبه شانزدهم فروردین 1388ساعت 8:28  توسط مهناز نسیمی  | 

برگزیده سوالات دی ماه جمعی از همکاران زیست شناسی گرمسار

نمونه سوالات درس علوم زیستی و بهداشت دی ماه 1387 شهرستان گرمسار

1- به سوالات تستی زیر پاسخ دهید:

A- کدام اندامک دو غشایی است ؟

1- واکوئل        2- دستگاه گلژی        3- میتوکندری                4- شبکه آندوپلاسمی

 

B- مقدار کلسترول در کدام ماده غذایی کم­تر است ؟

1- تخم­مرغ       2- سیب­زمینی           3- شیر                 4- گوشت


ادامه مطلب
+ نوشته شده در  شنبه پنجم بهمن 1387ساعت 21:32  توسط مهناز نسیمی  |